taleinat / Fuzzysearch
Programming Languages
Projects that are alternatives of or similar to Fuzzysearch
=========== fuzzysearch
.. image:: https://img.shields.io/pypi/v/fuzzysearch.svg?style=flat :target: https://pypi.python.org/pypi/fuzzysearch :alt: Latest Version
.. image:: https://img.shields.io/travis/taleinat/fuzzysearch.svg?branch=master :target: https://travis-ci.org/taleinat/fuzzysearch/branches :alt: Build & Tests Status
.. image:: https://img.shields.io/coveralls/taleinat/fuzzysearch.svg?branch=master :target: https://coveralls.io/r/taleinat/fuzzysearch?branch=master :alt: Test Coverage
.. image:: https://img.shields.io/pypi/wheel/fuzzysearch.svg?style=flat :target: https://pypi.python.org/pypi/fuzzysearch :alt: Wheels
.. image:: https://img.shields.io/pypi/pyversions/fuzzysearch.svg?style=flat :target: https://pypi.python.org/pypi/fuzzysearch :alt: Supported Python versions
.. image:: https://img.shields.io/pypi/implementation/fuzzysearch.svg?style=flat :target: https://pypi.python.org/pypi/fuzzysearch :alt: Supported Python implementations
.. image:: https://img.shields.io/pypi/l/fuzzysearch.svg?style=flat :target: https://pypi.python.org/pypi/fuzzysearch/ :alt: License
Fuzzy search: Find parts of long text or data, allowing for some changes/typos.
Easy, fast, and just works!
.. code:: python
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
-
Two simple functions to use: one for in-memory data and one for files
- Fastest search algorithm is chosen automatically
-
Levenshtein Distance metric with configurable parameters
- Separately configure the max. allowed distance, substitutions, deletions and/or insertions
-
Advanced algorithms with optional C and Cython optimizations
-
Properly handles Unicode; special optimizations for binary data
-
Simple installation:
-
pip install fuzzysearch
just works - pure-Python fallbacks for compiled modules
- only one dependency (
attrs
)
-
-
Extensively tested
-
Free software:
MIT license <LICENSE>
_
For more info, see the documentation <http://fuzzysearch.rtfd.org>
_.
Installation
fuzzysearch
supports Python versions 2.7 and 3.5+, as well as PyPy 2.7 and
3.6.
.. code::
$ pip install fuzzysearch
This will work even if installing the C and Cython extensions fails, using pure-Python fallbacks.
Usage
Just call find_near_matches()
with the sub-sequence you're looking for,
the sequence to search, and the matching parameters:
.. code:: python
>>> from fuzzysearch import find_near_matches
# search for 'PATTERN' with a maximum Levenshtein Distance of 1
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
To search in a file, use find_near_matches_in_file()
similarly:
.. code:: python
>>> from fuzzysearch import find_near_matches_in_file
>>> with open('data_file', 'rb') as f:
... find_near_matches_in_file(b'PATTERN', f, max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
Examples
fuzzysearch is great for ad-hoc searches of genetic data, such as DNA or protein sequences, before reaching for "heavier", domain-specific tools like BioPython:
.. code:: python
>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' # distance = 1
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1, matched="TAGCACTGTAGGGATAACAAT")]
BioPython sequences are also supported:
.. code:: python
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> sequence = Seq('''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG''', IUPAC.unambiguous_dna)
>>> subsequence = Seq('TGCACTGTAGGGATAACAAT', IUPAC.unambiguous_dna)
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1, matched="TAGCACTGTAGGGATAACAAT")]
Matching Criteria
The search function supports four possible match criteria, which may be supplied in any combination:
-
maximum Levenshtein distance (
max_l_dist
) -
maximum # of subsitutions
-
maximum # of deletions ("delete" = skip a character in the sub-sequence)
-
maximum # of insertions ("insert" = skip a character in the sequence)
Not supplying a criterion means that there is no limit for it. For this reason,
one must always supply max_l_dist
and/or all other criteria.
.. code:: python
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
# this will not match since max-deletions is set to zero
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1, max_deletions=0)
[]
# note that a deletion + insertion may be combined to match a substution
>>> find_near_matches('PATTERN', '---PAT-ERN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=1, matched="PAT-ERN")] # the Levenshtein distance is still 1
# ... but deletion + insertion may also match other, non-substitution differences
>>> find_near_matches('PATTERN', '---PATERRN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=2, matched="PATERRN")]
When to Use Other Tools
-
Use case: Search through a list of strings for almost-exactly matching strings. For example, searching through a list of names for possible slight variations of a certain name.
Suggestion: Consider using
fuzzywuzzy <https://github.com/seatgeek/fuzzywuzzy>
_.