SemiBin: Semi-supervised Metagenomic Binning Using Siamese Neural Networks
Command tool for metagenomic binning with semi-supervised deep learning using information from reference genomes in Linux and MacOS.
CONTACT US: This tool is still in development. You are welcome to try it out and feedback is appreciated, but expect some bugs/rapid changes until it stabilizes. Please use GitHub issues for bug reports and the SemiBin users mailing-list for more open-ended discussions or questions.
If you use this software in a publication please cite:
SemiBin: Incorporating information from reference genomes with semi-supervised deep learning leads to better metagenomic assembled genomes (MAGs) Shaojun Pan, Chengkai Zhu, Xing-Ming Zhao, Luis Pedro Coelho bioRxiv 2021.08.16.456517; doi: https://doi.org/10.1101/2021.08.16.456517
Basic usage of SemiBin
A tutorial of running SemiBin from scrath can be found here SemiBin tutorial.
Installation:
conda create -n SemiBin
conda activate SemiBin
conda install -c conda-forge -c bioconda semibin
The inputs to the SemiBin are contigs (assembled from the reads) and bam files (reads mapping to the contigs). In the docs you can see how to generate the inputs starting with a metagenome.
Running with single-sample binning (for example: human gut samples):
SemiBin single_easy_bin -i contig.fa -b *.bam -o output --environment human_gut
Running with multi-sample binning:
SemiBin multi_easy_bin -i contig_whole.fa -b *.bam -o output -s :
The output includes the bins in the output_recluster_bins directory (including the bin.*.fa and recluster.*.fa).
Please find more options and details below and read the docs.
Advanced Installation
SemiBin runs on Python 3.7-3.9.
Bioconda
The simplest mode is shown above. However, if you want to use SemiBin with GPU (which is faster if you have one available), you need to install PyTorch with GPU support:
conda create -n SemiBin
conda activate SemiBin
conda install -c conda-forge -c bioconda semibin
conda install -c pytorch-lts pytorch torchvision torchaudio cudatoolkit=10.2 -c pytorch-lts
MacOS note: you can only install the CPU version of PyTorch in MacOS with conda
and you need to install from source to take advantage of a GPU (see #72).
For more information on how to install PyTorch, see their documentation.
Source
You will need the following dependencies:
- MMseqs2
- Bedtools, Hmmer
- Prodigal
- (optionally) FragGeneScan
The easiest way to install the dependencies is with conda:
conda install -c conda-forge -c bioconda mmseqs2=13.45111 # (for GTDB support)
conda install -c bioconda bedtools hmmer prodigal
conda install -c bioconda fraggenescan
Once the dependencies are installed, you can install SemiBin by running:
python setup.py install
Examples of binning
NOTE: The SemiBin
API is a work-in-progress. The examples refer to
version 0.6
, but this may change in the near future (after the release of
version 1.0, we expect to freeze the API for at least 5
years). We are very happy
to hear any feedback on API
design, though.
SemiBin runs on single-sample, co-assembly and multi-sample binning. Here we show the simple modes as an example. For the details and examples of every SemiBin subcommand, please read the docs.
Easy single/co-assembly binning mode
Single sample and co-assembly are handled the same way by SemiBin.
You will need the following inputs:
- A contig file (
contig.fa
in the example below) - BAM file(s) from mapping short reads to the contigs (
mapped_reads.bam
in the example below)
The single_easy_bin
command can be used to produce results in a single step.
For example:
SemiBin \
single_easy_bin \
--input-fasta contig.fa \
--input-bam mapped_reads.bam \
--environment human_gut \
--output output
Alternatively, you can train a new model for that sample, by not passing in the --environment
flag:
SemiBin \
single_easy_bin \
--input-fasta contig.fa \
--input-bam mapped_reads.bam \
--output output
The following environments are supported:
human_gut
dog_gut
ocean
soil
cat_gut
human_oral
mouse_gut
pig_gut
built_environment
wastewater
global
The global
environment can be used if none of the others is appropriate.
Note that training a new model can take a lot of time and disk space.
Some patience will be required.
If you have a lot of samples from the same environment, you can also train a new model from them and reuse it.
Easy multi-samples binning mode
The multi_easy_bin
command can be used in multi-samples binning mode:
You will need the following inputs:
- A combined contig file
- BAM files from mapping
For every contig, format of the name is <sample_name>:<contig_name>
, where
:
is the default separator (it can be changed with the --separator
argument). NOTE: Make sure the sample names are unique and the separator
does not introduce confusion when splitting. For example:
>S1:Contig_1
AGATAATAAAGATAATAATA
>S1:Contig_2
CGAATTTATCTCAAGAACAAGAAAA
>S1:Contig_3
AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA
>S2:Contig_1
AATGATATAATACTTAATA
>S2:Contig_2
AAAATATTAAAGAAATAATGAAAGAAA
>S3:Contig_1
ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG
>S3:Contig_2
AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT
>S3:Contig_3
CAAATACGAATGATTCTTTATTAGATTATCTTAATAAGAATATC
You can use this to get the combined contig:
SemiBin concatenate_fasta -i contig*.fa -o output
You can get the results with one line of code.
SemiBin multi_easy_bin -i concatenated.fa -b *.bam -o output
Output
The output folder will contain:
- Datasets used for training and clustering
- Saved semi-supervised deep learning model
- Output bins
- Some intermediate files
By default, reconstructed bins are in output_recluster_bins
directory.
For more details about the output, read the docs.